Table 1

The reference collection of 14 gene pairs and 40 verified transcription-factor-binding sites used for testing

Gene name

Human sequence

Rodent sequence

Transcription factors

Binding sequence

Location

MEDLINE ID [49]


Skeletal muscle actin

AF182035*

M12347

SP1

GCGGGGTGGCGCG

-64/-51

11017083

SRF

ACCCAAATATGGCT

-100/ -86

1922033

TEF-1

GACATTCCTGCG

-73/-51

11017083

Aldolase A α B crystallin

X12447*

J05517

MEF2

CCTAAATATAGGTC

-125/-111

8413246

M28638*

U04320

SP1

AGGAGGAGGGGCA

-343/-330

11017083

SRF

GCCCAAGATAGTTG

-393/-379

11017083

Cardiac α myosin heavy chain

Z20656

U71441 and M62404*

MEF2

TTAAAAATAACTGA

-327/-313

8366095

TEF-1

AGGAGGAATGTGC

-239/-226

7961957

SRF

CTCCAAATTTAGGC

-62/-48

8782063

CEBPα

U34070*

M62362

AP2 α

GGCCGGGGGCGGA

-243/-232

9520389

TBP

TATAAAA

-30/-24

96003748

Cell division cycle protein 2

L06298 and

U69555

E2F

TCTTTCGCGC

-131/-119

94094909

X66172*

cETS

GGGAAG

-109/-104

951721551

Cholesterol 7 α hydroxylase

L13460

U01962*

HNF3 β

TCTGTTTGTTCT

-175/-166

9799805

cEBP

ATGTTATGTCA

-227/-217

28182075

Early growth response protein 1

AJ243425

M22326*

SRF

TGCTTCCCATATATGGCCATGT

-88/-67

90097904

SRF

CCAGCGCCTTATATGGAGTGGC

-358/-337

90097904

SRF

GAAACGCCATATAAGGAGCAGG

-412/-391

90097904

Glucose-6-phosphatase

AF051355*

U57552

HNF3 β

CCAAAGA

-72/-66

9369482

HNF3 β

ACAAACG

-91/-85

9369482

HNF3 β

GTTTTTGAG

-82/-74

9369482

HNF3 β

TGTGTGC

-180/-174

9369482

HNF3 β

TGTTTGC

-139/-133

9369482

HNF1

AGTTAATCATTGGCC

-226/-212

9369482

Leptin

U43589

U36238*

SP1

GGGCGG

-100/-95

9492033

cEBP

GTTGCGCAAG

-58/-49

9492033

TBP

TATAAG

-33/-28

9492033

Lipoprotein lipase

M29549*

M63335

NFY

CAAT

-65/-61

1918010

cEBP

TAGCCAAT

-68/-61

1918010

TBP

TATAA

-27/-23

1918010

Muscle creatine kinase

M21487

AF188002 and M21390*

SRF

CCATGTAAGG

-1236/-1227

93233638

AP2 α

GGCCTGGGGA

-1220/-1211

93233638

MEF2

TCTAAAAATAAC

-1078/-1067

93233638

MYF

GGGCCAGCTGTCCC

-253/-240

96347575

MYF

CCAACACCTGCTGC

-1157/-1144

96347575

P53

ATACAAGGCC

-176/-167

96047120

P53

ATACAAGGCC

-158/-149

96047120

Rb susceptibility gene

L11910*

M86180 U49920 and S66110

SP1

GGGCGG

-202/-188

1881452

Troponin I

L21905*

MEF2

AGACTATAATAGCC

-976/-962

9774679

MYF

TAAACAGGTGCAGC

-879/-865

9774679


GenBank accession numbers [41] are given for the human and rodent sequences. The transcription-factor-binding sequences refer to the human or rodent sequence(s) marked with an asterisk. 'Location' refers to the position of the TFBS relative to the transcription start site.

Lenhard et al. Journal of Biology 2003 2:13   doi:10.1186/1475-4924-2-13

Open Data